This is a SAMPLE AVA entry!

Links may not work.

Azotobacter vinelandii Genbank entry: (A. vinelandii records have been retrieved using the "Azotobacter vinelandii[ORGN]" search string on Entrez at NCBI.  Each entry represents a single open reading frame that has been extracted from the CDS feature of Genbank nucleotide records.  Some entries may have the same accession number but can be distinguished by a unique ProteinID or other features.  Entries with the same accession number were submitted at the same time and give some indication of proximity on the chromosome.)

>AF077373::AAD02836.1::sodB::metalloprotein containing iron as the transition metal::iron superoxide dismutase FeSOD [ origin ]>accession#::ProteinID::Gene name::Note::Product (Some may read "no_gene" etc. This does not indicate that a name has not been given nor that the product is unknown, only that one was not reported when the sequence was submitted.)

Genbank Entry (This links to the original Genbank record from which this entry was extracted.)

BLASTX results summary: [Links are the top 5 hsp's (high-scoring pairs) from the nr protein database.]

Matched SequenceScoreE-value
gi|4106403|gb|AAD02836.1| (AF077373) iron superoxide dismutase FeSOD [Azotobacter vinelandii] dbj|BAA88212.1| (AB025798) iron superoxide dismutase [Azotobacter vinelandii] 412 e-114
gi|15599562|ref|NP_253056.1| superoxide dismutase [Pseudomonas aeruginosa] sp|P53641|SODF_PSEAE SUPEROXIDE DISMUTASE [FE] pir||E83100 superoxide dismutase PA4366 [imported] - Pseudomonas aeruginosa (strain PAO1) gb|AAG07754.1|AE004852_7 (AE004852) superoxide dismutase [Pseudomonas aeruginosa] 382 e-105
gi|4581924|gb|AAD24797.1|AF121079_1 (AF121079) iron-superoxide dismutase [Pseudomonas syringae pv. syringae] 365 e-100
gi|2500825|sp|P77928|SODG_PSEPU SUPEROXIDE DISMUTASE [FE] gb|AAB06332.1| (U64798) iron superoxide dismutase [Pseudomonas putida] 357 3e-98
gi|12084342|pdb|1DT0|A Chain A, Cloning, Sequence, And Crystallographic Structure Of Recombinant Iron Superoxide Dismutase From Pseudomonas Ovalis pdb|1DT0|B Chain B, Cloning, Sequence, And Crystallographic Structure Of Recombinant Iron Superoxide Dismutase From Pseudomonas Ovalis pdb|1DT0|C Chain C, Cloning, Sequence, And Crystallographic Structure Of Recombinant Iron Superoxide Dismutase From Pseudomonas Ovalis 353 4e-97

Full BLAST Report (Link to the rest of the BLASTX output.  This is in raw text format, suitable for printing.)

Sequence: (The ORF itself, extracted from the CDS portion of the record, and will be used to design arrays.)

accession|AF077373|AAD02836.1|sodB|metalloprotein
ATGGCTTTTGAACTGCCGCCGCTGCCGTACGAGAAAAACGCCCTCGAGCCGTACATTTCCACCGAGACCCTGGAATACCA
CTACGGCAAGCACCACAACACCTATGTGGTGAACCTGAACAACCTGATCCCTGGTACCGAGTTCGAAGGCAAGAGCCTGG
AAGACATCGTCAAGACCTCTTCCGGCGGCATCTTCAACAACGCCGCTCAGGTCTGGAACCACACCTTCTACTGGAACGGC
CTGAAGCCGCAGGGCGGCGGTCAGCCGACCGGCCCCCTGGCCGATGCCATCAACGCGGCCTTCGGTTCCTTCGACAAGTT
TAAGGAAGAGTTCACCAAGGTCGCCATCGGCACCTTCGGCTCCGGCTGGGCCTGGCTGGTGAAGAAGGCCGACGGTTCCC
TGGCCCTGGCCAGCACCATCGGCGCCGGCAACCCGCTGACTTCCGGCGACACGCCGCTGCTGACCTGCGATGTCTGGGAA
CACGCCTACTACATCGACTACCGCAACCTGCGTCCGAAGTACGTCGAGGCATTCTGGAACCTGGTGAACTGGGATTTCGT
GGCCGCCAACTACGCCGCCTGA

Duplicates:

accession|AB025798|BAA88212.1|sodB (Links to duplicate entries.  These represent genes that have been submitted multiple times to the database.  The threshold for calling duplicates was >%93 identity on the nucleotide level.  Please write me if this presents obvious problems for determining unique entries.)